emulsion pcr.pdf - PDFQueen - PDF Search engine. Free unlimited pdf search and download.

by R Williams - 2006 - Cited by 35

http://www.weizmann.ac.il/Biological_Chemistry/scientist/Tawfik/papers/(48)Williams2006NatMethods.pdf

by AD Griffiths - Cited by 56

http://www.weizmann.ac.il/Biological_Chemistry/scientist/Tawfik/papers/(50)Griffiths2006TrendsBio.pdf

Efficiency of Emulsion PCR Decreases Markedly With Increasing Amplicon Length. We ... Emulsion PCR was performed as described Dressmann et al. ...

http://www.columbia.edu/cu/biology/courses/w3034/2008/readings/shendure-science2005-supplementarydata.pdf

by F Diehl - 2006 - Cited by 34

http://www.columbia.edu/cu/biology/courses/w3034/LACpapers/BEAMingNatMeth06.pdf

uses a gel instead of the emulsion in LE-PCR to isolate the template molecules, .... Emulsion PCR requires two primers for each of the two amplicons as ...

http://www.springerlink.com/index/nq854124g510v2w4.pdf

emulsion PCR (b), which clonally amplifies the DNA. Clonally amplified DNA containing beads are ... tion of emulsion PCR and pyrosequencing. The ability to ...

http://www.springerlink.com/index/22r2525580k45106.pdf

by D Dressman - 2003 - Cited by 140

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC166396/pdf/1008817.pdf

by JG Wetmur - 2005 - Cited by 19

http://www.epa.gov/ncer/childrenscenters/full_text/33546.pdf

Mix PCR aqueous phase into a water-in-oil (w/o) emulsion and carry out emulsion PCR ... emulsion PCR Individual Bead. 2) Polymerase extends from P1 ...

http://www.sb-roscoff.fr/SG/IMG/pdf/SOLiD_Chemistry_Presentation.pdf

Ultra Deep Sequencing of PCR Amplicons. ❑ Exploits the “instant cloning” in the emulsion PCR process and the 1000s of reads generated in a single run ...

http://www7.nationalacademies.org/gdest/GDEST_China_Presentation_Taillon.pdf

Preparation of the non cloned single stranded shotgun library (sstDNA) and clonal amplification by emulsion PCR (emPCR). Ultra high throughput sequencing ...

http://www.eurofinsdna.com/fileadmin/PDFs/brochure/brochure_genome_sequencing.pdf

Emulsion PCR and Beads on slides. • 85 mio reads / run. • Up to 35 bases/read ... Emulsion PCR/Bead Enrichment. Prepare clonal bead populations in ...

http://www.b-techconsulting.com/nextgensequencing.pdf

re-amplified these products by emulsion PCR to produce single-molecule clones on beads, of which around 80000 were sequenced per experiment. ...

https://lra.le.ac.uk/bitstream/2381/3833/1/MegaPlex.pdf

4) Parallel emulsion PCR (emPCR) amplification in microreactor bubbles: signal intensity!! 5) Dispense one bead per picotiter well (>400000 wells/plate) ...

http://www.bio.utk.edu/fesin/Copenhagen/Jumpponen.pdf

Barcoded libraries are ready to be combined into a multiplex sequencing pool just prior to templated bead preparation by emulsion PCR. ...

https://www3.appliedbiosystems.com/cms/groups/mcb_support/documents/generaldocuments/cms_068993.pdf

The 3′ (reverse) PCR primers in the SOLiD Transcriptome Multiplexing Kit contain the P2 sequence required for SOLiD emulsion PCR, a ...

http://www.ambion.com/techlib/spec/sp_4427046.pdf

time required to produce sequencing template, compared to emulsion Pcr methods. ... *Unlike emulsion PCR methods, processing multiplexed runs (>96 samples) ...

http://www.illumina.com/documents/products/datasheets/datasheet_cbot.pdf

454 Workflow: library construction ligates 454-specific adapters to DNA fragments and couples amplification beads with DNA in an emulsion PCR to amplify ...

http://lpm.hms.harvard.edu/palaver/sites/default/files/Impact of NGS technology.pdf

Clonal bead library generation via emulsion PCR. ... Emulsion PCR—a love-hate relationship that ... After PCR, break emulsions and recover beads ...

http://cage.unl.edu/454 technology.pdf

Barcode Emulsion PCR. P1. P2. Tag1. Tag2. AGGTTCCGATACGGATTACCATGTG .... emulsion PCR and sequencing reaction. Future advances of this feature include ...

http://www.edgebio.com/services/files/SOLiDT System Barcoding.pdf

Emulsion PCR, sequencing by synthesis using fluorescently ... Amplification of DNA by emulsion PCR. Gel free, microchips with 800000 holes ...

http://www.lehigh.edu/~inbios21/PDF/Fall2007/Marzillier101207.pdf

by JH Leamon - 2006 - Cited by 15

http://www.raindancetechnologies.com/documents/leamonetal2006_naturemethods.pdf

di-tagged fragments were enriched by limited-cycle PCR. The recovered library was used directly as input for Roche 454 FLX. Titanium emulsion PCR. ...

http://www.epibio.com/posters/AGBT_2010_Final_screen.pdf

primer design uses limited-cycle PCR to enrich di-tagged libraries. PCR products are compatible with emulsion PCR. (Roche/454) or bridge PCR ...

http://www.epibio.com/posters/PAG2010_DNA_Library_Preparation.pdf

Emulsion PCR (emPCR) and titration by enrichment at 0.5, 1, 2, 4 copies per bead (cpb) was carried out according to the 454 Titanium emPCR protocol to ...

http://www.pnas.org/content/suppl/2009/10/29/0909775106.DCSupplemental/0909775106SI.pdf

by M Meyer - 2008 - Cited by 25

http://email.eva.mpg.de/~paabo/pdf1/Meyer_From_NAR_2008.pdf

phosphorylated, A and B adapters , needed for subsequent emulsion PCR and sequencing primer annealing, were ligated to each end of the fragments using the ...

http://email.eva.mpg.de/~ptak/pdf/nature06_SupInfo.pdf

The library is not constructed by cloning, but by PCR, where the fragments are separated by physico-chemical means (emulsion PCR or bridge PCR). ...

http://marray.economia.unimi.it/2008/material/lectures/day5/HTS.pdf

20 Apr 2009 ... Templated Bead prepara{on ‐ Emulsion PCR – cont. Distribute emulsion into each well of a 96‐well PCR plate. E‐PCR reac{on ...

http://www.soe.ucsc.edu/classes/bme215/Spring09/PPT/BME 215-6.pdf

Emulsion PCR. 8.0 h. 7.5 h. 4.5 h and 10.5 h. DNA library preparation and titration. emPCR. Sequencing. Emulsion-based clonal amplification. Anneal sstDNA ...

http://www.soe.ucsc.edu/classes/bme215/Spring09/PPT/BME 215-5.pdf

by N Maeda - 2008 - Cited by 4

http://www.biotechniques.com/multimedia/archive/00001/BTN_A_000112814_O_1839a.pdf

2 Apr 2009 ... Emulsion PCR. Ligase. 454 Life Sciences / Roche. Emulsion PCR. Polymerase - pyrosequencing. Solexa/Illumina. Bridge PCR ...

http://openwetware.org/images/5/5a/20109_S09-M2Lec6_Samson.pdf

by LD van der Stap - Related articles

http://www.csrc.sdsu.edu/csrc/acsess/reports/ACSESS200805.pdf

SOLiD: bead-based emulsion PCR. 1 um bead size hundred million beads/slide. PCR primer complementary to Adaptor is covalently attached to bead ...

http://genomebiology.jgi-psf.org/Content/MGM_FEBR09_PPTS/02.Feng - NewSequencingTechnologies.pdf

by DNAS Trace - Related articles

http://www.sbs.utexas.edu/walker/fall08/STUDYGUIDE/LECTURE2/Lecture2B_review.pdf

introduced to emulsion PCR for 454 sequencing reactions. • We have developed an amplicon-tagging protocol that enables direct labeling of PCR products with ...

http://fluidim.com/pdf/posters/AGBT 2010 poster - May.pdf

3) Pooling, amplification and emulsion PCR (ePCR). ThePCR products for each target are pooled and enriched for the ~ 150 bp fragments. ...

http://www.covarisinc.com/pdf/Rita_MzMtg_poster_022608f.pdf

Emulsion PCR. Sequencing chemistry. Sequencing by ligation. Read length. 35 and 50 (fixed). Reads per run. >1000M. Mbp per run. 60Gbp. Accuracy ...

http://www.microarray.be/download/VION_20100223/VION2010_WouterVanDelm_NGSplatforms.pdf

Emulsion PCR was performed on pooled library samples as described in the SOLiD™ System documentation (Applied Biosystems). Sequencing ...

http://www3.appliedbiosystems.com/cms/groups/mcb_marketing/documents/generaldocuments/cms_065528.pdf

(i) start, monitor and validate a run; (ii) will create templated beads by setting up emulsion PCR and will do a library titration to optimize emulsion PCR. ...

http://www3.appliedbiosystems.com/cms/groups/mcb_support/documents/generaldocuments/cms_079774.pdf

10 May 2005 ... Emulsion PCR confines two amplicons of two linked ... which combines linking PCR (16) and emulsion PCR to pro- ...

http://nar.oxfordjournals.org/cgi/reprint/33/8/2615.pdf

15 Dec 2007 ... Emulsion PCR involves mixing single-stranded library ... utilizes the emulsion PCR priming sites for performing a ...

http://nar.oxfordjournals.org/cgi/screenpdf/gkm1095v1.pdf

Clonal amplification on beads (emulsion PCR) was performed using reagents. (emPCR kits II and III; 454 Life Sciences) that enable bidirectional sequencing. ...

http://retroconference.org/2010/PDFs/547.pdf

Fragments of DNA are ligated to adapters and amplified on beads by emulsion PCR. The. DNA is denatured and the beads deposited onto a glass slide. ...

http://petang.cgu.edu.tw/Bioinfomatics/Lecture/0_NGS.pdf

emulsion PCR. - sequencing by ligation. - read lengths ca. 35 bp first instrument in June 2007 first instrument in Oct 2005 first instrument in July 2006 ...

http://bits09.istge.it/slides/Tutorial1-Ciccarelli.pdf

concentrated for emulsion PCR. Step 3: SOLiD Sequencing. The purified small RNA libraries are compatible with the standard SOLiD ...

http://innovations.appliedbiosystems.eu.com/pdf/10015.pdf

by PCP Cons - 2009 - Related articles

http://www.microarrays.ca/info/2009Jan_NGS_SynergyWithArrays.pdf

4．Fragment size estimation. （peak at 500bp）. 5.Emulsion development. 6. Bead-fragment emulsion PCR. 7．Beads washing and amplification. Before PCR ...

http://grain.jouy.inra.fr/ITMI/2008/PAG08ITMIKazSato.pdf

19 Feb 2009 ... single fragments on beads, and amplifying those bead-fragments through emulsion PCR. The DNA on the beads is denatured and each bead is then ...

http://biochem218.stanford.edu/Projects 2009/Chung2009.pdf

Emulsion PCR. Bridge PCR. Emulsion PCR. Polymerase;. Fluorescent-di- deoxy terminators. Polymerase; Pyrosequencing. Polymerase;. Reversible terminators ...

http://www.ilsi-india.org/Conference-on-biotechnology-based-sustainable-agriculture/Session 2B/Dr. J P Khurana.pdf